Peanut Marker Database

GM2584 Information

Marker name GM2584
Marker category Publicly available markers
Primer sequences Fw ACATTTTCAGCACCCTTCCTT
Rv ACTCGTCAATGTTCCCTTGTG
EST/Genome sequences GO336619
Lines
PIC Value
Lines
Map Integrated consensus map Linkage B09
Position 0.0
Integrated consensus map Linkage A09
Position 65.45
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Nagy et al. (2010)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea