Marker name | Ai119H15 | ||
---|---|---|---|
Marker category | Publicly available markers | ||
Primer sequences | Fw | CCCTTCATTCTCCCTCTTTTCT | |
Rv | CAAGCAATGGCAACTTCAGATA | ||
EST/Genome sequences | Ai119H15 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Map | SKF2 | Linkage | LG08.2 |
Position | 36.496 | ||
NYF2 | Linkage | LG08.2 | |
Position | 49.418 | ||
Integrated consensus map | Linkage | B08 | |
Position | 80.161 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | ||
Pattern* | |||
Repeat count | |||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | |||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Leal-Bertioli et al. (2009) ABS0081 |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.