Peanut Marker Database

Ai119C17 Information

Marker name Ai119C17
Marker category Publicly available markers
Primer sequences Fw AAATGTGGAGTCAGTCTCTCCG
Rv CAAGGCAGGACTTTTGGATTAC
EST/Genome sequences Ai119C17
Lines
PIC Value
Lines
Map SKF2 Linkage LG09.1
Position 68.5565
Integrated consensus map Linkage B09
Position 83.896
Integrated consensus map Linkage A01
Position 83.246
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
ABS0069

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea