Marker name | AhTE1018 | ||
---|---|---|---|
Marker category | Transposable Element | ||
Primer sequences | Fw | TGGGATGTGAAGGGAGAAAG | |
Rv | AAATGAAGATGGCAAAAACATC | ||
EST/Genome sequences | KITE1138 | ||
Lines | 10 | ||
PIC | Value | ||
Lines | |||
Map | NYF2 | Linkage | LG06.2 |
Position | 146.51 | ||
TF6 | Linkage | TA06 | |
Position | 108.39 | ||
Integrated consensus map | Linkage | A06 | |
Position | 107.973 | ||
Integrated consensus map | Linkage | B06 | |
Position | 152.473 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | ||
Pattern* | |||
Repeat count | |||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | image6124.jpg,image8131.jpg | ||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Shirasawa et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.