Peanut Marker Database

AhTE0710 Information

Marker name AhTE0710
Marker category Transposable Element
Primer sequences Fw CTTTGTTTGTTTAGCCACACTTT
Rv AGCACGACACGCTAACTCG
EST/Genome sequences SATE0057
Lines 10
PIC Value
Lines
Map SKF2 Linkage LG03.2
Position 48.989
BF6 Linkage BB05
Position 11.291
Integrated consensus map Linkage B05
Position 44.814
Integrated consensus map Linkage A03
Position 80.727
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image image6047.jpg,image8045.jpg
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea