Peanut Marker Database

AhTE0633 Information

Marker name AhTE0633
Marker category Transposable Element
Primer sequences Fw TCCTTCAGTGAAACAGATGGC
Rv ATTCTTGTTTCGGTTTTGCG
EST/Genome sequences SATE0933
Lines 10
PIC Value
Lines
Map SKF2 Linkage LG07.2
Position 98.079
TF6 Linkage TB07
Position 19.566
TF6 Linkage TA05
Position 32.565
Integrated consensus map Linkage A05
Position 58.108
Integrated consensus map Linkage B07
Position 75.055
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image image6028.jpg,image8106.jpg
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea