Peanut Marker Database

AhTE0586 Information

Marker name AhTE0586
Marker category Transposable Element
Primer sequences Fw CATTGTCTCGTTCGCGTTTA
Rv GAACGTGGGGAAAGTCAAAA
EST/Genome sequences SATE0730
Lines 10
PIC Value
Lines
Map SKF2 Linkage LG02.2
Position 64.003
TF6 Linkage TA10
Position 22.687
TF6 Linkage TB10
Position 32.177
Integrated consensus map Linkage B10
Position 86.91
Integrated consensus map Linkage A10
Position 107.97
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image image6016.jpg,image8132.jpg
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea