Peanut Marker Database

AhTE0552 Information

Marker name AhTE0552
Marker category Transposable Element
Primer sequences Fw GCAACAAAAATTCTCGAAAGC
Rv TCTGCTTATGCTTCCTCCTACC
EST/Genome sequences SATE0395
Lines 10
PIC Value
Lines
Map SKF2 Linkage LG03.1
Position 52.669
TF6 Linkage TA03
Position 99.495
Integrated consensus map Linkage B03
Position 74.97
Integrated consensus map Linkage A03
Position 142.868
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image image6006.jpg,image8100.jpg
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea