Peanut Marker Database

AhTE0537 Information

Marker name AhTE0537
Marker category Transposable Element
Primer sequences Fw GCATGTTTAAGCGGGTGATT
Rv TGATTTTCATACGCTGTTGACT
EST/Genome sequences SATE0241
Lines 10
PIC Value
Lines
Map SKF2 Linkage LG02.1
Position 25.82
TF6 Linkage TB02
Position 45.548
TF6 Linkage TA02
Position 75.34
Integrated consensus map Linkage A02
Position 64.308
Integrated consensus map Linkage B02
Position 93.028
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image image6003.jpg,image8099.jpg
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea