Peanut Marker Database

AhTE0498 Information

Marker name AhTE0498
Marker category Transposable Element
Primer sequences Fw ATGACTTACATGTAGCAATTG
Rv TGAAAGGAGTCAAAGGTCATG
EST/Genome sequences AhTE8iHP7F14
Lines 8
PIC Value
Lines
Map SKF2 Linkage LG03.1
Position 57.275
TF6 Linkage TA03
Position 96.037
Integrated consensus map Linkage B03
Position 133.562
Integrated consensus map Linkage A03
Position 135.072
SNP Position
Method
SSR Fragment size 342
Pattern*
Repeat count
Method PCR 58
Detection
Multiplex
Gel image image4157.jpg,image8098.jpg
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea