Marker name | AhTE0477 | ||
---|---|---|---|
Marker category | Transposable Element | ||
Primer sequences | Fw | GGTGGTGGCCATTTCTCTT | |
Rv | TTTGCCCATTTTTGGTTCTG | ||
EST/Genome sequences | AhTE8iXS9O14 | ||
Lines | 8 | ||
PIC | Value | ||
Lines | |||
Map | SKF2 | Linkage | LG08.1 |
Position | 99.826 | ||
AF5 | Linkage | AA08 | |
Position | 49.683 | ||
TF6 | Linkage | TA08 | |
Position | 53.573 | ||
Integrated consensus map | Linkage | A08 | |
Position | 68.177 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 529 | |
Pattern* | |||
Repeat count | |||
Method | PCR | MAPTD | |
Detection | |||
Multiplex | |||
Gel image | image4148.jpg,image8096.jpg | ||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Shirasawa et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.