Peanut Marker Database

AhTE0443 Information

Marker name AhTE0443
Marker category Transposable Element
Primer sequences Fw TTGGCCTTTGATACCTGCTC
Rv TGAACGCAGGAAGGAAGATT
EST/Genome sequences AhTE8iHP7I20
Lines 8
PIC Value
Lines
Map NYF2 Linkage LG05.2
Position 84.15
TF6 Linkage TB05
Position 59.094
TF6 Linkage TA05
Position 33.843
Integrated consensus map Linkage A05
Position 59.245
Integrated consensus map Linkage B05
Position 94.525
SNP Position
Method
SSR Fragment size 389
Pattern*
Repeat count
Method PCR 58
Detection
Multiplex
Gel image image4131.jpg,image8143.jpg
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea