Peanut Marker Database

AhTE0392 Information

Marker name AhTE0392
Marker category Transposable Element
Primer sequences Fw CCCCACATGGCTTATTTGAG
Rv TACACGCTGTCAACGTCCAG
EST/Genome sequences AhTE8i09J02
Lines 8
PIC Value
Lines
Map NYF2 Linkage LG07.1
Position 46.791
TF6 Linkage TA09
Position 29.681
Integrated consensus map Linkage A09
Position 84.206
Integrated consensus map Linkage A07
Position 120.431
SNP Position
Method
SSR Fragment size 542
Pattern*
Repeat count
Method PCR 58
Detection
Multiplex
Gel image image4123.jpg,image8142.jpg
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea