Peanut Marker Database

AhTE0372 Information

Marker name AhTE0372
Marker category Transposable Element
Primer sequences Fw GCAATTTGGCATAGCCTCTC
Rv CGTATTGACAAGGGTTCCGT
EST/Genome sequences AhTE8i04L04
Lines 8
PIC Value
Lines
Map NYF2 Linkage LG06.2
Position 45.986
TF6 Linkage TB06
Position 33.937
TF6 Linkage TA06
Position 59.536
Integrated consensus map Linkage A06
Position 56.958
Integrated consensus map Linkage B06
Position 50.218
SNP Position
Method
SSR Fragment size 464
Pattern*
Repeat count
Method PCR 58
Detection
Multiplex
Gel image image4119.jpg,image8141.jpg
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea