Peanut Marker Database

AhTE0371 Information

Marker name AhTE0371
Marker category Transposable Element
Primer sequences Fw GCTGAATCCTCTTCTGCCAC
Rv CCAGAAACCGTTTTGCTGTAT
EST/Genome sequences AhTE8i04J12
Lines 8
PIC Value
Lines
Map NYF2 Linkage LG02.1
Position 36.311
AF5 Linkage AA07
Position 6.488
TF6 Linkage TA02
Position 53.997
TF6 Linkage TB02
Position 21.286
Integrated consensus map Linkage A07
Position 66.115
Integrated consensus map Linkage B02
Position 61.406
Integrated consensus map Linkage A02
Position 46.15
SNP Position
Method
SSR Fragment size 435
Pattern*
Repeat count
Method PCR 58
Detection
Multiplex
Gel image image4119.jpg,image8141.jpg
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea