Marker name | AhTE0347 | ||
---|---|---|---|
Marker category | Transposable Element | ||
Primer sequences | Fw | ACACTGAGTCACGCAGCAAT | |
Rv | TGAAGTTTGGAGAGGATGCC | ||
EST/Genome sequences | AhTE8i01N21 | ||
Lines | 8 | ||
PIC | Value | ||
Lines | |||
Map | SKF2 | Linkage | LG04.1 |
Position | 15.983 | ||
BF6 | Linkage | BB04 | |
Position | 47.49 | ||
TF6 | Linkage | TA01 | |
Position | 12.488 | ||
Integrated consensus map | Linkage | B04 | |
Position | 90.798 | ||
Integrated consensus map | Linkage | A01 | |
Position | 44.992 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 325 | |
Pattern* | |||
Repeat count | |||
Method | PCR | 58 | |
Detection | |||
Multiplex | |||
Gel image | image4115.jpg,image8091.jpg | ||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Shirasawa et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.