Peanut Marker Database

AhTE0335 Information

Marker name AhTE0335
Marker category Transposable Element
Primer sequences Fw GACAAAGGTAGAGGTTAATCCCA
Rv CCTAACATTGGGTTGGAGGA
EST/Genome sequences AhTE8i01H04
Lines 8
PIC Value
Lines
Map SKF2 Linkage LG04.1
Position 49.343
TF6 Linkage TB04
Position 13.117
TF6 Linkage TA04
Position 54.694
Integrated consensus map Linkage A04
Position 50.985
Integrated consensus map Linkage B04
Position 70.439
SNP Position
Method
SSR Fragment size 426
Pattern*
Repeat count
Method PCR 58
Detection
Multiplex
Gel image image4113.jpg,image8091.jpg
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea