Peanut Marker Database

AhTE0251 Information

Marker name AhTE0251
Marker category Transposable Element
Primer sequences Fw GCGTCGTCTTCAATTAGGTTACT
Rv AAAGATCAACAAAGAGCAATGAAA
EST/Genome sequences AhTE8i_HP1_D23
Lines 8
PIC Value
Lines
Map SKF2 Linkage LG01.2
Position 28.22
TF6 Linkage TB01
Position 32.088
TF6 Linkage TA08
Position 48.456
Integrated consensus map Linkage A08
Position 62.216
Integrated consensus map Linkage B01
Position 46.677
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR 58
Detection
Multiplex
Gel image image4081.jpg,image8086.jpg
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea