Peanut Marker Database

AhTE0197 Information

Marker name AhTE0197
Marker category Transposable Element
Primer sequences Fw TTTGCTGGCTCTTTGAATTTTT
Rv TGATCAATGGAATGAGAGCTATTG
EST/Genome sequences AhTE8i_PV0_E16
Lines 8
PIC Value
Lines
Map SKF2 Linkage LG10.2(t)
Position 16.527
BF6 Linkage BB06
Position 29.546
TF6 Linkage TA06
Position 84.068
TF6 Linkage TA06
Position 106.404
Integrated consensus map Linkage B06
Position 99.33
Integrated consensus map Linkage A06
Position 84.978
Integrated consensus map Linkage A06
Position 88.43
Integrated consensus map Linkage A06
Position 106.224
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR 58
Detection
Multiplex
Gel image image4047.jpg,image4048.jpg,image8082.jpg
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea