Peanut Marker Database

AhTE0194 Information

Marker name AhTE0194
Marker category Transposable Element
Primer sequences Fw TGATCGATACAATTACGCGTTC
Rv CACTTCCCATAGCACTGTCTTG
EST/Genome sequences AhTE8i_PV0_A16
Lines 8
PIC Value
Lines
Map SKF2 Linkage LG03.1
Position 63.239
TF6 Linkage TB03
Position 69.313
TF6 Linkage TA03
Position 48.599
Integrated consensus map Linkage A03
Position 92.932
Integrated consensus map Linkage B03
Position 62.831
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR 58
Detection
Multiplex
Gel image image4045.jpg,image4046.jpg,image8082.jpg
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea