Peanut Marker Database

AhTE0162 Information

Marker name AhTE0162
Marker category Transposable Element
Primer sequences Fw CTTGCGATCAATGAGGTTATCA
Rv CCACCTTCCAAATTCATATTGC
EST/Genome sequences AhTE8i_AL0_K21
Lines 8
PIC Value
Lines
Map SKF2 Linkage LG02.2
Position 32.029
TF6 Linkage TB10
Position 20.422
TF6 Linkage TA10
Position 8.192
Integrated consensus map Linkage A10
Position 92.91
Integrated consensus map Linkage B10
Position 64.308
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR 58
Detection
Multiplex
Gel image image4041.jpg,image4042.jpg,image8079.jpg
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea