Peanut Marker Database

AhTE0122 Information

Marker name AhTE0122
Marker category Transposable Element
Primer sequences Fw TTCAGGCGGTTTTCGTATTC
Rv TCACATCGAAATCATGAGAGG
EST/Genome sequences AhTE8i07K09
Lines 8
PIC Value
Lines
Map SKF2 Linkage LG09.1
Position 16.834
TF6 Linkage TA09
Position 43.984
TF6 Linkage TB09
Position 50.228
Integrated consensus map Linkage A09
Position 70.502
Integrated consensus map Linkage B09
Position 106.049
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR 58
Detection
Multiplex
Gel image image4024.jpg,image8078.jpg
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea