Peanut Marker Database

AhTE0010 Information

Marker name AhTE0010
Marker category Transposable Element
Primer sequences Fw GCCGTGTCATTCCACAAAG
Rv TGGACAATGCTGTTTGTCGT
EST/Genome sequences AhMITElib_8i_30
Lines 8
PIC Value
Lines
Map SKF2 Linkage LG09.1
Position 14.222
NYF2 Linkage LG09.2
Position 5.716
TF6 Linkage TA09
Position 44.455
TF6 Linkage TB09
Position 46.984
Integrated consensus map Linkage B09
Position 105.351
Integrated consensus map Linkage A09
Position 71.365
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR 58
Detection
Multiplex
Gel image image4150.jpg,image8146.jpg
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea