Marker name | AhTE0010 | ||
---|---|---|---|
Marker category | Transposable Element | ||
Primer sequences | Fw | GCCGTGTCATTCCACAAAG | |
Rv | TGGACAATGCTGTTTGTCGT | ||
EST/Genome sequences | AhMITElib_8i_30 | ||
Lines | 8 | ||
PIC | Value | ||
Lines | |||
Map | SKF2 | Linkage | LG09.1 |
Position | 14.222 | ||
NYF2 | Linkage | LG09.2 | |
Position | 5.716 | ||
TF6 | Linkage | TA09 | |
Position | 44.455 | ||
TF6 | Linkage | TB09 | |
Position | 46.984 | ||
Integrated consensus map | Linkage | B09 | |
Position | 105.351 | ||
Integrated consensus map | Linkage | A09 | |
Position | 71.365 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | ||
Pattern* | |||
Repeat count | |||
Method | PCR | 58 | |
Detection | |||
Multiplex | |||
Gel image | image4150.jpg,image8146.jpg | ||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Shirasawa et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.