Peanut Marker Database

AhTE0001 Information

Marker name AhTE0001
Marker category Transposable Element
Primer sequences Fw AATGTCCATGGCTCCTTGTC
Rv ACCCCATCCTTTCAGACACA
EST/Genome sequences AhMITElib_8i_01
Lines 8
PIC Value
Lines
Map SKF2 Linkage LG04.1
Position 28.536
TF6 Linkage TB04
Position 56.69
TF6 Linkage TB04
Position 34.152
Integrated consensus map Linkage B04
Position 94.142
Integrated consensus map Linkage B04
Position 94.617
Integrated consensus map Linkage B04
Position 113.784
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR 58
Detection
Multiplex
Gel image image4149.jpg,image8072.jpg
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea