Peanut Marker Database

Ah594 Information

Marker name Ah594
Marker category Publicly available markers
Primer sequences Fw TGACCAAATCATCCCATCTTGC
Rv CAGCACATCTCCAACTTTCTCCA
EST/Genome sequences DQ099308
Lines
PIC Value
Lines
Map Integrated consensus map Linkage A07
Position 78.816
Integrated consensus map Linkage A01
Position 79.009
Integrated consensus map Linkage A04
Position 91.659
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Moretzsohn et al. (2004)
ABS0255

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea