Peanut Marker Database

Ah569 Information

Marker name Ah569
Marker category Publicly available markers
Primer sequences Fw GCGTTTTAGAGCCCCATTTGAG
Rv CATGGACATAGCAGCACAAACAAC
EST/Genome sequences DQ099303
Lines
PIC Value
Lines
Map AF5 Linkage AA04
Position 50.542
Integrated consensus map Linkage B04
Position 84.275
Integrated consensus map Linkage A04
Position 65.942
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Moretzsohn et al. (2004)
ABS0252

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea