Peanut Marker Database

Ah41 Information

Marker name Ah41
Marker category Publicly available markers
Primer sequences Fw CGCCACAAGATTAACAAGCACC
Rv GCTGGGATCATTGTAGGGAAGG
EST/Genome sequences DQ099247
Lines
PIC Value
Lines
Map TF6 Linkage TA03
Position 54.145
TF6 Linkage TB03
Position 88.31
Integrated consensus map Linkage B03
Position 76.057
Integrated consensus map Linkage A03
Position 92.682
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Moretzsohn et al. (2004)
ABS0211

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea