Peanut Marker Database

Ah3 Information

Marker name Ah3
Marker category Publicly available markers
Primer sequences Fw TCGGAGAACAAGCACACATC
Rv TTGCGCTCTTTCTCACACTC
EST/Genome sequences Ah3
Lines
PIC Value
Lines
Map AF5 Linkage AA05
Position 53.371
BF6 Linkage BB01
Position 11.658
TF6 Linkage TB01
Position 34.429
TF6 Linkage TA01
Position 92.765
Integrated consensus map Linkage A01
Position 125.171
Integrated consensus map Linkage A05
Position 54.53
Integrated consensus map Linkage B01
Position 42.453
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Gimenes et al. (2007)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea