Peanut Marker Database

Ad90J24 Information

Marker name Ad90J24
Marker category Publicly available markers
Primer sequences Fw AATCAAAACTTGTTCCACCCAC
Rv ATACTCTGTGCTCGCAGTGAAG
EST/Genome sequences Ad90J24
Lines
PIC Value
Lines
Map SKF2 Linkage LG08.2
Position 84.379
TF6 Linkage TA03
Position 45.795
Integrated consensus map Linkage B08
Position 78.291
Integrated consensus map Linkage A03
Position 91.498
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
ABS0013

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea