Peanut Marker Database

Ad90F2 Information

Marker name Ad90F2
Marker category Publicly available markers
Primer sequences Fw CTCAATGGCCGGTATGATTAGT
Rv TTGAGATAACGCTTCCGAAAAT
EST/Genome sequences Ad90F2
Lines
PIC Value
Lines
Map Integrated consensus map Linkage B08
Position 50.799
Integrated consensus map Linkage A08
Position 72.849
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Leal-Bertioli et al. (2009)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea