Peanut Marker Database

AHS3174 Information

Marker name AHS3174
Marker category EST-SSR
Primer sequences Fw AAATTGTTTGATAATTTCGGCAA
Rv CAATGGAGCTCCTCTTCCTG
EST/Genome sequences AHCR20C13
Lines
PIC Value
Lines
Map SKF2 Linkage LG05.2
Position 41.428
TF6 Linkage TA05
Position 21.923
Integrated consensus map Linkage B05
Position 45.146
Integrated consensus map Linkage A05
Position 51.457
SNP Position
Method
SSR Fragment size 185
Pattern* AAT(mis2)
Repeat count 5
Method PCR
Detection
Multiplex
Gel image AHS3151_3175.ppt [download]
Enzyme
Related markers Marker name
Species
Comments
Koilkonda et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea