Peanut Marker Database

AHS3173 Information

Marker name AHS3173
Marker category EST-SSR
Primer sequences Fw AGGGATAGGGCAATTCATGC
Rv CCTGAGGTCAAAGGAGTTGAA
EST/Genome sequences AHCR20A14
Lines
PIC Value
Lines
Map BF6 Linkage BB09
Position 23.325
BF6 Linkage BB09
Position 24.286
TF6 Linkage TA09
Position 49.042
Integrated consensus map Linkage B09
Position 82.235
Integrated consensus map Linkage A09
Position 64.57
Integrated consensus map Linkage B09
Position 80.785
SNP Position
Method
SSR Fragment size 277
Pattern* AAG(mis2)
Repeat count 5
Method PCR
Detection
Multiplex
Gel image AHS3151_3175.ppt [download]
Enzyme
Related markers Marker name
Species
Comments
Koilkonda et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea