| Marker name | AHS2911 | ||
|---|---|---|---|
| Marker category | EST-SSR | ||
| Primer sequences | Fw | TTGCAGTGCCCAATATTTCA | |
| Rv | CACCCCTTAGATTGGCAAAA | ||
| EST/Genome sequences | AHCR20K08 | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Map | AF5 | Linkage | AA05 |
| Position | 52.209 | ||
| Integrated consensus map | Linkage | A05 | |
| Position | 53.385 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 300 | |
| Pattern* | AT(mis1) | ||
| Repeat count | 11 | ||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image |
AHS2901_2925.ppt [download] |
||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | Koilkonda et al. (2012) | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.