Peanut Marker Database

AHS2897 Information

Marker name AHS2897
Marker category EST-SSR
Primer sequences Fw ATGCAAGATCTGATCCCAGG
Rv TCCCCAGCTAGCAACCTAAA
EST/Genome sequences AHCR13D12
Lines
PIC Value
Lines
Map AF5 Linkage AA05
Position 6.158
BF6 Linkage BB05
Position 59.476
Integrated consensus map Linkage B05
Position 98.94
Integrated consensus map Linkage A05
Position 13.234
SNP Position
Method
SSR Fragment size 274
Pattern* AAAT
Repeat count 5
Method PCR
Detection
Multiplex
Gel image AHS2876_2900.ppt [download]
Enzyme
Related markers Marker name
Species
Comments
Koilkonda et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea