Peanut Marker Database

AHS2854 Information

Marker name AHS2854
Marker category EST-SSR
Primer sequences Fw CCCCATTGGACAAGAAAGAA
Rv GAATGGGACGAGGAATACGA
EST/Genome sequences AHCR10J19
Lines
PIC Value
Lines
Map BF6 Linkage BB10
Position 29.453
TF6 Linkage TA10
Position 19.033
Integrated consensus map Linkage B10
Position 70.652
Integrated consensus map Linkage A10
Position 105.0
SNP Position
Method
SSR Fragment size 229
Pattern* AAC(mis2)
Repeat count 5
Method PCR
Detection
Multiplex
Gel image AHS2851_2875.ppt [download]
Enzyme
Related markers Marker name
Species
Comments
Koilkonda et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea