Peanut Marker Database

AHS2850 Information

Marker name AHS2850
Marker category EST-SSR
Primer sequences Fw ACCTTCTTCCCCAATTCACC
Rv TGTGAGGTTGTGGCAGTGAT
EST/Genome sequences AHCR10B04
Lines
PIC Value
Lines
Map BF6 Linkage BB01
Position 9.389
BF6 Linkage BB01
Position 1.37
Integrated consensus map Linkage B01
Position 31.716
Integrated consensus map Linkage B01
Position 40.603
SNP Position
Method
SSR Fragment size 300
Pattern* GGA(mis2)
Repeat count 5
Method PCR
Detection
Multiplex
Gel image AHS2826_2850.ppt [download]
Enzyme
Related markers Marker name
Species
Comments
Koilkonda et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea