| Marker name | AHS2794 | ||
|---|---|---|---|
| Marker category | EST-SSR | ||
| Primer sequences | Fw | TCGCAGCGTAGCAAACAGTA | |
| Rv | ACaCaCTTTGGCCTTTGGAG | ||
| EST/Genome sequences | AHCR05B05 | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Map | BF6 | Linkage | BB06 |
| Position | 27.417 | ||
| TF6 | Linkage | TA06 | |
| Position | 99.602 | ||
| Integrated consensus map | Linkage | A06 | |
| Position | 99.741 | ||
| Integrated consensus map | Linkage | B06 | |
| Position | 95.991 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 218 | |
| Pattern* | AAG(mis2) | ||
| Repeat count | 5 | ||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image |
AHS2776_2800.ppt [download] |
||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | Koilkonda et al. (2012) | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.