Peanut Marker Database

AHS2590 Information

Marker name AHS2590
Marker category EST-SSR
Primer sequences Fw ATGGCTTACAGCATCCCAAT
Rv GGGTGGAAGACAAGCACATT
EST/Genome sequences AHCR10F24
Lines
PIC Value
Lines
Map BF6 Linkage BB09
Position 15.351
TF6 Linkage TA05
Position 10.708
Integrated consensus map Linkage B09
Position 71.697
Integrated consensus map Linkage A05
Position 35.517
SNP Position
Method
SSR Fragment size 193
Pattern* AT(mis1)
Repeat count 11
Method PCR
Detection
Multiplex
Gel image AHS2576_2600.ppt [download]
Enzyme
Related markers Marker name
Species
Comments
Koilkonda et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea