Peanut Marker Database

AHS2553 Information

Marker name AHS2553
Marker category EST-SSR
Primer sequences Fw CCTCTCTGTCTTTCGATGCC
Rv GCGGGCCTCTAGATCTTCTT
EST/Genome sequences AHCR04E15
Lines
PIC Value
Lines
Map TF6 Linkage TA05
Position 36.991
TF6 Linkage TB05
Position 61.036
Integrated consensus map Linkage B05
Position 101.727
Integrated consensus map Linkage A05
Position 60.822
SNP Position
Method
SSR Fragment size 160
Pattern* AAC
Repeat count 9
Method PCR
Detection
Multiplex
Gel image AHS2551_2575.ppt [download]
Enzyme
Related markers Marker name
Species
Comments
Koilkonda et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea