Peanut Marker Database

AHS2547 Information

Marker name AHS2547
Marker category EST-SSR
Primer sequences Fw TTCGaaaTTCCATCAAAGCC
Rv GTGGCGAGAAGAATCGAGAG
EST/Genome sequences AHCR04C24
Lines
PIC Value
Lines
Map TF6 Linkage TA04
Position 67.452
TF6 Linkage TB04
Position 23.354
Integrated consensus map Linkage B04
Position 80.691
Integrated consensus map Linkage A04
Position 59.965
SNP Position
Method
SSR Fragment size 248
Pattern* AAAG
Repeat count 8
Method PCR
Detection
Multiplex
Gel image AHS2526_2550.ppt [download]
Enzyme
Related markers Marker name
Species
Comments
Koilkonda et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea