Peanut Marker Database

AHS2541 Information

Marker name AHS2541
Marker category EST-SSR
Primer sequences Fw AGAGAGAACCCTCAGCCACA
Rv CAAGCAGGTGCTGGTACTGA
EST/Genome sequences AHCR04G22
Lines
PIC Value
Lines
Map BF6 Linkage BB01
Position 8.695
BF6 Linkage BB08
Position 24.776
TF6 Linkage TA01
Position 43.567
Integrated consensus map Linkage A01
Position 77.125
Integrated consensus map Linkage B01
Position 43.466
Integrated consensus map Linkage B08
Position 81.188
SNP Position
Method
SSR Fragment size 229
Pattern* GGC
Repeat count 13
Method PCR
Detection
Multiplex
Gel image AHS2526_2550.ppt [download]
Enzyme
Related markers Marker name
Species
Comments
Koilkonda et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea