Peanut Marker Database

AHS2430 Information

Marker name AHS2430
Marker category EST-SSR
Primer sequences Fw AATAAGGTGGTGGTCCATGC
Rv GGGAATCTGCAAAGCCATTA
EST/Genome sequences AHCL11L14
Lines
PIC Value
Lines
Map BF6 Linkage BB03
Position 32.387
TF6 Linkage TA03
Position 69.327
Integrated consensus map Linkage B03
Position 68.374
Integrated consensus map Linkage A03
Position 109.148
SNP Position
Method
SSR Fragment size 232
Pattern* AAT(mis2)
Repeat count 5
Method PCR
Detection
Multiplex
Gel image AHS2426_2450.ppt [download]
Enzyme
Related markers Marker name
Species
Comments
Koilkonda et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea