Marker name | AHS2382 | ||
---|---|---|---|
Marker category | EST-SSR | ||
Primer sequences | Fw | TTCGTTGAACTTCATGTCGC | |
Rv | CTCCCACAAATCTCTCCCAA | ||
EST/Genome sequences | AHCL15I15 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Map | AF5 | Linkage | AA05 |
Position | 17.642 | ||
AF5 | Linkage | AA01 | |
Position | 21.508 | ||
Integrated consensus map | Linkage | A01 | |
Position | 79.438 | ||
Integrated consensus map | Linkage | A05 | |
Position | 24.4 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 252 | |
Pattern* | AGC(mis2) | ||
Repeat count | 6 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image |
AHS2376_2400.ppt [download] |
||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Koilkonda et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.