Peanut Marker Database

AHS2364 Information

Marker name AHS2364
Marker category EST-SSR
Primer sequences Fw TTCCCTCACACCTCTTCACC
Rv TGATTTCACAACAAGGCTGC
EST/Genome sequences AHCL11B15
Lines
PIC Value
Lines
Map BF6 Linkage BB09
Position 15.434
BF6 Linkage BB09
Position 19.266
TF6 Linkage TA09
Position 34.434
Integrated consensus map Linkage B09
Position 71.316
Integrated consensus map Linkage A09
Position 79.019
Integrated consensus map Linkage B09
Position 67.999
SNP Position
Method
SSR Fragment size 138
Pattern* GGA(mis2)
Repeat count 6
Method PCR
Detection
Multiplex
Gel image AHS2351_2375.ppt [download]
Enzyme
Related markers Marker name
Species
Comments
Koilkonda et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea