Peanut Marker Database

AHS2276 Information

Marker name AHS2276
Marker category EST-SSR
Primer sequences Fw TACATTCCTTCAACCCTCGC
Rv GGATTCTAGTGGAGGTGGCA
EST/Genome sequences AHCL19O07
Lines
PIC Value
Lines
Map TF6 Linkage TA09
Position 35.152
TF6 Linkage TA03
Position 48.19
Integrated consensus map Linkage A03
Position 91.013
Integrated consensus map Linkage A09
Position 80.013
SNP Position
Method
SSR Fragment size 136
Pattern* AAG
Repeat count 9
Method PCR
Detection
Multiplex
Gel image AHS2276_2300.ppt [download]
Enzyme
Related markers Marker name
Species
Comments
Koilkonda et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea