Peanut Marker Database

AHS2228 Information

Marker name AHS2228
Marker category EST-SSR
Primer sequences Fw CCACCATTTTGGTGCTCTCT
Rv AGGTGGAGTTGGAGTTGGTG
EST/Genome sequences AHCL07D21
Lines
PIC Value
Lines
Map AF5 Linkage AA04
Position 35.673
AF5 Linkage AA08
Position 25.693
AF5 Linkage AA03
Position 0.487
AF5 Linkage AA03
Position 4.573
Integrated consensus map Linkage A03
Position 62.979
Integrated consensus map Linkage A03
Position 66.512
Integrated consensus map Linkage A04
Position 53.968
Integrated consensus map Linkage A08
Position 43.221
SNP Position
Method
SSR Fragment size 200
Pattern* GGT(mis2)
Repeat count 5
Method PCR
Detection
Multiplex
Gel image AHS2226_2250.ppt [download]
Enzyme
Related markers Marker name
Species
Comments
Koilkonda et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea