Peanut Marker Database

AHS2059 Information

Marker name AHS2059
Marker category EST-SSR
Primer sequences Fw TGCACCCACTGAACAACATT
Rv CCCTCGTTTTCACGAACAAT
EST/Genome sequences AHCL03D11
Lines
PIC Value
Lines
Map AF5 Linkage AA07
Position 25.118
BF6 Linkage BB07
Position 35.514
Integrated consensus map Linkage B07
Position 90.302
Integrated consensus map Linkage A07
Position 81.34
SNP Position
Method
SSR Fragment size 235
Pattern* AAAG(mis2)
Repeat count 5
Method PCR
Detection
Multiplex
Gel image AHS2051_2075.ppt [download]
Enzyme
Related markers Marker name
Species
Comments
Koilkonda et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea