Peanut Marker Database

AHS1950 Information

Marker name AHS1950
Marker category EST-SSR
Primer sequences Fw CGGCATTCACCCACTTTC
Rv TTGAGGTCAGTGTGCCAGAG
EST/Genome sequences AHCL01L20
Lines
PIC Value
Lines
Map AF5 Linkage AA09
Position 2.765
TF6 Linkage TB09
Position 60.701
Integrated consensus map Linkage B09
Position 97.318
Integrated consensus map Linkage A09
Position 68.973
SNP Position
Method
SSR Fragment size 242
Pattern* AG
Repeat count 19
Method PCR
Detection
Multiplex
Gel image AHS1926_1950.ppt [download]
Enzyme
Related markers Marker name
Species
Comments
Koilkonda et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea