Peanut Marker Database

AHS1949 Information

Marker name AHS1949
Marker category EST-SSR
Primer sequences Fw TCAACAATTTCAGCAGCACC
Rv GGAGTGAAAGCAGCACTTCC
EST/Genome sequences AHCL01M19
Lines
PIC Value
Lines
Map AF5 Linkage AA10
Position 10.727
TF6 Linkage TA02
Position 72.963
Integrated consensus map Linkage A10
Position 105.402
Integrated consensus map Linkage A02
Position 66.37
SNP Position
Method
SSR Fragment size 155
Pattern* AAG
Repeat count 14
Method PCR
Detection
Multiplex
Gel image AHS1926_1950.ppt [download]
Enzyme
Related markers Marker name
Species
Comments
Koilkonda et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea