Peanut Marker Database

AHS1777 Information

Marker name AHS1777
Marker category EST-SSR
Primer sequences Fw TATCACTCCGTTGGCATTCA
Rv ACCATGGGTTGGGTAGATGA
EST/Genome sequences AHCS17E18
Lines
PIC Value
Lines
Map AF5 Linkage AA01
Position 45.957
AF5 Linkage AA05
Position 43.312
Integrated consensus map Linkage A05
Position 45.803
Integrated consensus map Linkage A01
Position 98.606
SNP Position
Method
SSR Fragment size 276
Pattern* AG(mis2)
Repeat count 11
Method PCR
Detection
Multiplex
Gel image AHS1776_1800.ppt [download]
Enzyme
Related markers Marker name
Species
Comments
Koilkonda et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea